Lab 2: PRELAB

PRELAB ASSIGNMENT

Answer the following pre-lab questions in your lab notebook. Note that you will need to review the lab protocol in detail in order to complete both this assignment and the quiz.

  • What will you be doing in lab and why?
  • What should you end up with at the end of the lab period? Where will it be located?
  • Come to lab with as many of the reaction calculations completed as possible (see procedure that follows).
  • Choose the appropriate primer sets you will need to amplify the HCAII gene and pETblue2 vector.  Choose from the primers listed below (you will learn how to design primers in this lab; however, you will not use your primers for the PCR due to time constraint).
    • Vector and insert each need to be amplified with overlapping sequence to allow for Gibson assembly in Lab 4 (see lecture for more information). Therefore:
      • Your insert forward primer should contain the HCAII start site such that it overlaps with the start site indicated in pETblue2.
      • The stop codon in the HCAII gene has to be removed since you want to use the vector’s his-tag and stop codon. You need to keep the 3′ end of HCAII in frame so that the His-tag in the vector will be expressed.
    • The map of the vector and the HCAII gene 5′ and 3′ end sequences are provided as a pdf at this link (opens in a new tab): pETblue2 map.
    • You can also find the entire sequence of the HCAII gene in Appendix I, but that is not needed to answer this Prelab question.
    • Choose which primers will be used for which reaction, and write out the full sequences in the pre-lab section of your lab notebook. Highlight key features, such as: start codon, his-tag, stop codon, insert vs vector sequence.

Primers available:

Primer A:

5’ GTTTAACTTTAAGAAGGAGATATACCATGGCCCATCACTGGGGGTACGGCAAAC 3’

Primer B:

5’ GAACAGGCAAATCAAAGCTTCCTTCAAACACCACCACCACCACCACTAATGTTAATTAAG 3’

Primer C:

5’ GTTTGCCGTACCCCCAGTGATGGGCCATGGTATATCTCCTTCTTAAAGTTAAAC 3’

Primer D:

5’ CTTAATTAACATTAGTGGTGGTGGTGGTGGTGTTTGAAGGAAGCTTTGATTTGCCTGTTC 3’

If you have trouble choosing primers, you can watch the tutorial below. Note: it is highly recommended that you work through the problem first before watching the tutorial, as you will need to design/choose primers in future quizzes and the exam.

 


PRELAB QUIZ

You can take the quiz in Canvas here (link opens in a new tab): Prelab 2 Quiz

The quiz questions are also listed below for your convenience:

Question 1

You will be provided a 5X reaction buffer stock.

You want your 50 uL reaction to have a final concentration of 1X reaction buffer.

How many uL of the 5X stock must you add to each reaction?

Question 2

You will be provided a 10 mM dNTP stock.

You want your 50 uL reaction to have a final concentration of 200 uM dNTP.

How many uL of the dNTP stock must you add to each reaction?

Question 3

You will be provided a 1 U/uL Phusion enzyme stock.

You want your 50 uL reaction to contain 1 U Phusion.

How many uL of the Phusion stock must you add to each reaction?

License

Biochemistry 551 Lab Manual Copyright © by Lynne Prost. All Rights Reserved.