Lab 2: PROCEDURE Part 1
PROCEDURE: PCR
Note: This is the first of several “simulated labs” focused on studying HCAII. The protocols for these labs are written as though you were doing the lab in person, and they include every step that would be required to do so. You are expected to review the protocols before coming to lab, and will be asked about them on the pre-lab quiz. One of your in-lab activities will be to go through the protocol with a partner, and you will have a chance to ask your TAs questions.
Begin by choosing the appropriate primer sets you will need to amplify the HCAII gene and pETblue2 vector. Choose from the primers listed below.
-
- Vector and insert each need to be amplified with overlapping sequence to allow for Gibson assembly (see lecture for more information). If this is done correctly, you will ultimately be able to express his-tagged HCAII protein from your construct. Therefore:
- Your insert forward primer should contain the HCAII start site such that it overlaps with the start site indicated in pETblue2.
- The stop codon in the HCAII gene has to be removed since you want to use the vector’s his-tag and stop codon. You need to keep the 3′ end of HCAII in frame so that the His-tag in the vector will be expressed.
- The map of the vector and the HCAII gene 5′ and 3′ end sequences are provided as a pdf at this link (opens in a new tab): pETblue2 map
- Choose which primers will be used for which reaction before coming to lab. Do your best. When you arrive to lab, you will discuss with a partner.
- Vector and insert each need to be amplified with overlapping sequence to allow for Gibson assembly (see lecture for more information). If this is done correctly, you will ultimately be able to express his-tagged HCAII protein from your construct. Therefore:
Primers available:
Primer A:
5’ GTTTAACTTTAAGAAGGAGATATACCATGGCCCATCACTGGGGGTACGGCAAAC 3’
Primer B:
5’ GAACAGGCAAATCAAAGCTTCCTTCAAACACCACCACCACCACCACTAATGTTAATTAAG 3’
Primer C:
5’ GTTTGCCGTACCCCCAGTGATGGGCCATGGTATATCTCCTTCTTAAAGTTAAAC 3’
Primer D:
5’ CTTAATTAACATTAGTGGTGGTGGTGGTGGTGTTTGAAGGAAGCTTTGATTTGCCTGTTC 3’
Next, calculate the volume of all of the components for the three different reactions you will be running.
This quick video explains how to do the dilution calculations for PCR, and includes some practice problems:
The table below lists each reagent needed for PCR, the stock solutions that you will be provided, and the desired final reaction conditions:
| Reagent | Stock Solutions Provided | Desired Final Reaction Conditions |
| Buffer | 5x | 1x |
| dNTP mix | 10 mM (includes 10 mM of each nucleotide) | 200 μM |
| Template | x ng/μL (actual concentration will be provided in lab) | 10 ng |
| Forward primer | 10 μM | 400 nM |
| Reverse primer | 10 μM | 400 nM |
| Phusion polymerase | 1 U/μL (A “U” or “unit” is a standard way of measuring an amount of enzyme in a solution, and relates to its activity) | 1 U |
| Sterile water | To a final volume of 50 μL |
Use the information above to create a table that looks like the one below. You should arrive to lab with as much of the table completed as possible. You will finish it with a partner in-lab.
Remember that you will be setting up three separate PCRs:
Reaction #1: HCAII template, insert primers
Reaction #2: pETblue2 template, vector primers
Reaction #3: HCAII template, insert primers, no Phusion (negative control)
| Reagent | Reaction 1: Insert | Reaction 2: Vector | Reaction 3: negative control |
| 5X reaction buffer | |||
| dNTP mix | |||
| Primer A | |||
| Primer B | |||
| Primer C | |||
| Primer D | |||
| DNA template | |||
| H20 | |||
| Phusion | |||
| Total Volume | 50 μL | 50 μL | 50 μL |
Finally, set up your reactions! Once you are confident in your calculations, get your aliquots from the stock bench. Keep the aliquots and your PCRs on ice until you put them into the thermocycler. This will help maintain the activity of your Phusion enzyme.
Prepare the reactions, per your calculations, into PCR tubes. It is important that you label the PCR tubes clearly and in a way that will allow you to distinguish your reactions from your classmates’. The teaching staff will take the PCRs out of the machines the next morning, and all the tubes will be placed into one large freezer box.
Be sure to add Phusion to the reaction last. Use caution when pipetting small volumes! Once all the components have been added to the tubes, mix them with a pipette or by gently flicking the tubes. Do not vortex! Centrifuge briefly in the nanofuge to be sure the samples are all at the bottom of the tubes. You can spin the tiny PCR tubes by placing them inside a 1.5 mL eppendorf tube (people sometimes break the caps off the eppendorf tubes and save them as centrifuge adaptors).
Programming the thermocycler
Once you have finished setting up your PCRs, program the thermocycler to run the following program (also refer back to Figure 2.4):
Step 1: 98 °C for 30 seconds
Step 2: 98 °C for 10 seconds
Step 3: 50 °C for 30 seconds
Step 4: 72 °C for 2 mins
Repeat steps 2–4 for 35 cycles
Step 5: 72 °C for 10 mins
Step 6: 10 °C hold
Keep the reactions on ice while programming the thermocycler.
You need about four people per thermocycler, so don’t start the program until at least four people are ready.
