Lab 2: PROCEDURE Part 1

PROCEDURE: PCR

Note: This is the first of several “simulated labs” focused on studying HCAII. The protocols for these labs are written as though you were doing the lab in person, and they include every step that would be required to do so. You are expected to review the protocols before coming to lab, and will be asked about them on the pre-lab quiz. One of your in-lab activities will be to go through the protocol with a partner, and you will have a chance to ask your TAs questions.

Begin by choosing the appropriate primer sets you will need to amplify the HCAII gene and pETblue2 vector.  Choose from the primers listed below.

    • Vector and insert each need to be amplified with overlapping sequence to allow for Gibson assembly (see lecture for more information). If this is done correctly, you will ultimately be able to express his-tagged HCAII protein from your construct. Therefore:
      • Your insert forward primer should contain the HCAII start site such that it overlaps with the start site indicated in pETblue2.
      • The stop codon in the HCAII gene has to be removed since you want to use the vector’s his-tag and stop codon. You need to keep the 3′ end of HCAII in frame so that the His-tag in the vector will be expressed.
    • The map of the vector and the HCAII gene 5′ and 3′ end sequences are provided as a pdf at this link (opens in a new tab): pETblue2 map
    • Choose which primers will be used for which reaction before coming to lab. Do your best. When you arrive to lab, you will discuss with a partner.

Primers available:

Primer A:

5’ GTTTAACTTTAAGAAGGAGATATACCATGGCCCATCACTGGGGGTACGGCAAAC 3’

Primer B:

5’ GAACAGGCAAATCAAAGCTTCCTTCAAACACCACCACCACCACCACTAATGTTAATTAAG 3’

Primer C:

5’ GTTTGCCGTACCCCCAGTGATGGGCCATGGTATATCTCCTTCTTAAAGTTAAAC 3’

Primer D:

5’ CTTAATTAACATTAGTGGTGGTGGTGGTGGTGTTTGAAGGAAGCTTTGATTTGCCTGTTC 3’


Next, calculate the volume of all of the components for the three different reactions you will be running.

This quick video explains how to do the dilution calculations for PCR, and includes some practice problems:

 

The table below lists each reagent needed for PCR, the stock solutions that you will be provided, and the desired final reaction conditions:

Reagent Stock Solutions Provided Desired Final Reaction Conditions
Buffer 5x 1x
dNTP mix 10 mM (includes 10 mM of each nucleotide) 200 μM
Template x ng/μL (actual concentration will be provided in lab) 10 ng
Forward primer 10 μM 400 nM
Reverse primer 10 μM 400 nM
Phusion polymerase 1 U/μL (A “U” or “unit” is a standard way of measuring an amount of enzyme in a solution, and relates to its activity) 1 U
Sterile water To a final volume of 50 μL

Use the information above to create a table that looks like the one below. You should arrive to lab with as much of the table completed as possible. You will finish it with a partner in-lab.

Remember that you will be setting up three separate PCRs:

Reaction #1: HCAII template, insert primers

Reaction #2: pETblue2 template, vector primers

Reaction #3: HCAII template, insert primers, no Phusion (negative control)

Reagent Reaction 1: Insert Reaction 2: Vector Reaction 3: negative control
5X reaction buffer
dNTP mix
Primer A
Primer B
Primer C
Primer D
DNA template
H20
Phusion
Total Volume 50 μL 50 μL 50 μL

 


Finally, set up your reactions! Once you are confident in your calculations, get your aliquots from the stock bench. Keep the aliquots and your PCRs on ice until you put them into the thermocycler. This will help maintain the activity of your Phusion enzyme.

Prepare the reactions, per your calculations, into PCR tubes. It is important that you label the PCR tubes clearly and in a way that will allow you to distinguish your reactions from your classmates’. The teaching staff will take the PCRs out of the machines the next morning, and all the tubes will be placed into one large freezer box.

Be sure to add Phusion to the reaction last. Use caution when pipetting small volumes! Once all the components have been added to the tubes, mix them with a pipette or by gently flicking the tubes. Do not vortex! Centrifuge briefly in the nanofuge to be sure the samples are all at the bottom of the tubes. You can spin the tiny PCR tubes by placing them inside a 1.5 mL eppendorf tube (people sometimes break the caps off the eppendorf tubes and save them as centrifuge adaptors).

Programming the thermocycler

Once you have finished setting up your PCRs, program the thermocycler to run the following program (also refer back to Figure 2.4):

Step 1: 98 °C for 30 seconds

Step 2: 98 °C for 10 seconds

Step 3: 50 °C for 30 seconds

Step 4: 72 °C for  2 mins

Repeat steps 2–4 for 35 cycles

Step 5: 72 °C for 10 mins

Step 6: 10 °C hold

Keep the reactions on ice while programming the thermocycler.

You need about four people per thermocycler, so don’t start the program until at least four people are ready.

NOTE: Stopping the thermocycler during a run can ruin the reactions.

 

License

Icon for the Creative Commons Attribution 4.0 International License

Biochemistry 551 (Online Version) Lab Manual Copyright © by Lynne PROST is licensed under a Creative Commons Attribution 4.0 International License, except where otherwise noted.